A practical reference on MC4 receptor: what it is, how it behaves, what the literature reports, and where the honest uncertainties sit.
Reviewed 2025-10-28. Anything still debated is marked as such rather than presented as settled.
Published research covers ischemic stroke, traumatic brain injury, cognitive impairment, optic nerve conditions and attention-related measures. Much of the human evidence comes from small trials conducted in one country, which limits how far the results generalize. Animal models supply the larger share of the data, and effects seen in rodents do not transfer automatically to people. Reviews have noted that methodological reporting is often incomplete, making it difficult to pool results or compare treatment schedules across studies.
Pharmacokinetic accounts emphasize rapid breakdown. After intravenous dosing the intact peptide disappears from blood within minutes, and nasal delivery produces low but measurable concentrations. Metabolites rather than the parent molecule may account for part of the observed activity, although the relative contribution is unresolved. Dosing in the literature varies widely and no optimal schedule has been agreed. These gaps are regularly cited as a reason the findings have not produced broad clinical adoption beyond the original research setting.
Proposed mechanisms center on neurotrophic signaling rather than on classical melanocortin receptor activation. Rodent experiments have reported shifts in the expression of brain-derived neurotrophic factor and nerve growth factor after administration, together with changes in the associated receptor systems. Several authors argue that the peptide acts largely through its degradation products and their interaction with peptidergic pathways, but this remains a hypothesis rather than a settled finding. No single molecular target has been identified in a way that the field broadly accepts.
Claims about enhanced focus, memory, or mood in healthy people rest mostly on anecdotal reports and community discussion rather than on controlled data. It remains unclear whether any cognitive benefit observed in patients recovering from brain injury would extend to uninjured users. Dose-response relationships, long-term safety, and interactions with other drugs are not well characterized in the peer-reviewed literature. Questions about optimal route of administration and treatment duration likewise remain open.
Semax binds to melanocortin receptors and is thought to influence neuronal survival and plasticity rather than to act through the adrenal axis. Laboratory work has shown increased expression of brain-derived neurotrophic factor and nerve growth factor in treated tissue. Changes in c-Fos, a marker of neuronal activation, have also been reported. Because the peptide is rapidly degraded by peptidases, its effects are generally attributed to downstream signaling cascades rather than to sustained receptor occupancy.
| Property | Value | Notes |
|---|---|---|
| Primary research models | Rodent studies | Largest share of published data |
| Reported markers | BDNF and NGF expression | Measured mainly in animal tissue |
| Common administration | Intranasal | Matches the registered formulation |
| Blood residence time | Minutes | Rapid enzymatic degradation |
| Evidence quality | Small trials, limited replication | Noted repeatedly in reviews |
Circulation time for the peptide is short because peptidases cleave it readily. The Pro-Gly-Pro tail is thought to slow breakdown compared with the bare ACTH fragment, but the gain appears modest. Absorption after intranasal dosing is limited, and only a fraction of a dose is expected to reach the central nervous system. Laboratory concentrations therefore sit well above levels achieved systemically, a gap that complicates translation from bench findings to clinical claims.
The mechanisms attributed to semax are inferred from animal and cell studies rather than traced to one confirmed target. The most frequently cited pathway involves increased expression of brain-derived neurotrophic factor and nerve growth factor in hippocampal and cortical tissue. Some work points to engagement of melanocortin receptors, particularly MC4, which the parent ACTH fragment can activate. Effects on dopaminergic and serotonergic signalling have also been reported. No single account explains all observed results, and the relative weight of each pathway remains unsettled.
Southern Rhodesia's fighting contributions in Britain and western Europe were primarily in the air, as part of the much larger Allied forces. Rhodesian pilots and Allied airmen trained in the colony's flying schools participated in the defence of Britain throughout the war, as well as in the strategic bombing of Germany and other operations. Rhodesia provided the only RAF flying ace of the Norwegian Campaign of April–June 1940, Squadron Leader Caesar Hull. Later that year "The Few", the Allied airmen of the Battle of Britain, included three pilots of Southern Rhodesian birth—Hull, Pilot Officer John Chomley and Flight Lieutenant John Holderness—of whom two, Hull and Chomley, lost their lives. Two of the RAF's three Rhodesian squadrons, Nos. 44 and 266, operated from England during the war. No. 266 (Rhodesia) Squadron, a fighter squadron based in Cambridgeshire for most of the duration, was initially only nominally Rhodesian, being manned by a mixture of British and Commonwealth personnel, but it received more airmen from the colony gradually and was virtually all Rhodesian by August 1941. Initially flying Spitfires, it switched to Typhoons in early 1942. It took as its motto the Sindebele word Hlabezulu ("Stabber of Skies") and first went into action over Dunkirk on 2 June 1940, after which it fought in the Battle of Britain. The squadron's duties thereafter included patrolling, protecting convoys, sweeping around northern France and the Belgian and Dutch coasts, and escorting bombing raids over France and the Rhine. No.
== Structure == The chordae tendineae connect the atrioventricular valves (tricuspid and mitral), to the papillary muscles within the ventricles. Multiple chordae tendineae attach to each leaflet or cusp of the valves. Chordae tendineae contain elastin in a delicate structure notably at their periphery.
== In fiction == Excretion was traditionally a taboo subject in fiction and was rarely depicted explicitly, although later works have used it for satire, worldbuilding, horror and speculation about technology. The Encyclopedia of Science Fiction notes examples ranging from the reversed social taboos surrounding defecation in Brian Aldiss's The Dark Light Years (1964) to waste-recycling technologies in works such as Frank Herbert's Dune (1965), while spaceflight fiction has sometimes addressed the practical problems of sanitation and waste disposal. Depictions can also serve social or political purposes: Ursula K. Le Guin's "The Ones Who Walk Away from Omelas" (1973) associates excrement with the degradation of the abused child on whom its utopian society depends, while later works have employed toilets and excretion for comedy, horror and speculative depictions of future technology.
Barq's Cream Soda – clear Big 8 Cream Soda – pink and clear Cott Cream Soda Crush – pink and clear Fanta Jones Soda Kiri Cream Soda – clear Life Brand The Pop Shoppe – also markets a vodka-based alcoholic version President's Choice - clear Walmart Canada – US-style vanilla flavor Some American brands are available in Canada as imports.
The strain lacked the outer membrane proteins OmpF and OmpC, and showed increased expression of a multidrug efflux pump, but did not produce carbapenemase. CR Pseudomonas aeruginosa is commonly present in intensive-care units, and can lead to dangerous infections. In Thai hospitals, of 261 multidrug-resistant samples collected of P. aeruginosa (not part of the Enterobacteriaceae), 71.65% were carbapenem-resistant.
Sources: en.wikipedia.org
Raleigh is the home of Raleigh Kubb, both a competitive and non-competitive kubb club. Raleigh Kubb hosts kubb tournaments benefitting various charities in the Raleigh area. The Raleigh Parks and Recreation Department offers a wide variety of leisure opportunities at more than 200 sites throughout the city, which include: 8,100 acres (33 km2) of park land, 78 mi (126 km) of greenway, 22 community centers, a BMX championship-caliber race track, 112 tennis courts among 25 locations, 5 public lakes, and 8 public aquatic facilities. The park system includes the historic Pullen Park, the oldest public park in North Carolina. The J. C. Raulston Arboretum, an 8-acre (32,000 m2) arboretum and botanical garden in west Raleigh administered by North Carolina State University, maintains a year-round collection that is open daily to the public without charge.
=== Compression gloves === Compression gloves are handwear designed to help prevent the occurrence of various medical disorders relating to blood circulation in the wrists and hands. They can be used to treat the symptoms of arthritis, though the medical benefits may be limited.
== Toxicity == The neurotoxicity of MCD peptide is distincted from its histamine releasing function. The histamine releasing function of MCD peptide, at low concentrations, causes the degranulation of mast cell , and shows anti-inflammatory activity at higher concentrations. These actions of MCD peptide on mast cells is thought to be involved in allergic and inflammatory processes related to type I hypersensitivity reaction. MCD peptide shows neurotoxicity by inducing epileptiform seizures in rat, when intraventricularly injected. This toxicity is caused by the blockage of voltage-gated potassium channels by the MCD peptide. However, there is no toxicity of MCD administered peripherally, even at high doses.
Acute erythema nodosum Bowel-associated dermatosis–arthritis syndrome (bowel bypass syndrome, bowel bypass syndrome without bowel bypass, intestinal bypass arthritis–dermatitis syndrome) Marshall syndrome Neutrophilic dermatosis of the dorsal hands (pustular vasculitis of the dorsal hands) Neutrophilic eccrine hidradenitis Pyoderma gangrenosum Pyogenic arthritis–pyoderma gangrenosum–acne syndrome (PAPA syndrome) Rheumatoid neutrophilic dermatitis (rheumatoid neutrophilic dermatosis) Superficial granulomatous pyoderma Sweet's syndrome (acute febrile neutrophilic dermatosis) Sweet's syndrome-like dermatosis Vesicopustular dermatosis
Stone-lifting competitions were practiced in ancient Egypt, Greece, and Tamilakam. Western weightlifting developed in Europe from 1880 to 1953, with strongmen displaying feats of strength for the public and challenging each other. The focus was not on their physique, and they possessed relatively large bellies and fatty limbs compared to bodybuilders of today.
Sources: en.wikipedia.org
=== 2020 === On 9 March 2020, Sensex tumbled down by 1941.67 points amid the fears of coronavirus pandemic and Yes Bank crisis. This was the second worst single-day fall in the history, where the investors lost ₹6.50 lakh crores ($91 billion). While on 12 March 2020, the index plunged down by 2919.26 points, the second–worst fall in the history, ending in red to a 33-month low at 32,778.14. The fall wiped off ₹11.2 lakh crores wealth ($160 billion). On Friday, 13 March, trading was halted for 45 minutes for the first time in 12 years since January 2008 due to lower circuit. Sensex touched a low of 29,687.52 down by 3090.62 points (or 9.43%). However, after the 45-minute halt, the index saw biggest intra-day recovery by 5,380 points to end up by 1325 points. Continuing the losing streak, wealth worth ₹14.22 lakh crore ($200 Billion) was erased on 23 March 2020 as BSE SENSEX lost 3,934.72 points to end at 25,981.24. As on 21 January 2021, Sensex has recovered to 50,167.71.
==== Musculoskeletal pain ==== The benefits of paracetamol in musculoskeletal conditions, such as osteoarthritis and backaches, are uncertain. It appears to provide only small and not clinically important benefits in osteoarthritis. The guidelines of the American College of Rheumatology and Arthritis Foundation for the management of osteoarthritis note that the effect size in clinical trials of paracetamol has been very small, suggesting that for most individuals it is ineffective. The guideline conditionally recommends short-term and episodic use of paracetamol to those who do not tolerate nonsteroidal anti-inflammatory drugs. For people taking it regularly, monitoring for liver toxicity is required. The same recommendation was issued by the European League Against Rheumatism for hand osteoarthritis. Similarly, the ESCEO algorithm for the treatment of knee osteoarthritis recommends limiting the use of paracetamol to short-term rescue analgesia only. Paracetamol is ineffective for acute low back pain. No randomized clinical trials evaluated its use for chronic or radicular back pain, and the evidence in favor of paracetamol is lacking.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
The human immunodeficiency virus (or HIV) is a difficult target to find and eradicate. The earliest tests for infection relied on the presence of antibodies to the virus circulating in the bloodstream. However, antibodies don't appear until many weeks after infection, maternal antibodies mask the infection of a newborn, and therapeutic agents to fight the infection don't affect the antibodies. PCR tests have been developed that can detect as little as one viral genome among the DNA of over 50,000 host cells. Infections can be detected earlier, donated blood can be screened directly for the virus, newborns can be immediately tested for infection, and the effects of antiviral treatments can be quantified. Some disease organisms, such as those for tuberculosis, are difficult to sample from patients and slow to be grown in the laboratory. PCR-based tests have allowed detection of small numbers of disease organisms (both live and dead) in convenient samples. Detailed genetic analysis can also be used to detect antibiotic resistance, allowing immediate and effective therapy. The effects of therapy can also be immediately evaluated. The spread of a disease organism through populations of domestic or wild animals can be monitored by PCR testing. In many cases, the appearance of new virulent subtypes can be detected and monitored. The subtypes of an organism that were responsible for earlier epidemics can also be determined by PCR analysis. Viral DNA can be detected by PCR.
Excess deaths throughout World War I and the Russian Civil War (including the famine of 1921–1922 that was triggered by Lenin's war communism policies) amounted to a combined total of 18 million, some 10 million in the 1930s, and more than 20 million in 1941–1945. The postwar Soviet population was 45 to 50 million smaller than it would have been if pre-war demographic growth had continued. According to Catherine Merridale, "[...] a reasonable estimate would place the total number of excess deaths for the whole period somewhere around 60 million." The birth rate of the USSR decreased from 44.0 per thousand in 1926 to 18.0 in 1974, mainly due to increasing urbanization and the rising average age of marriages. The mortality rate demonstrated a gradual decrease as well—from 23.7 per thousand in 1926 to 8.7 in 1974. In general, the birth rates of the southern republics in Transcaucasia and Central Asia were considerably higher than those in the northern parts of the Soviet Union, and in some cases even increased in the post–World War II period, a phenomenon partly attributed to slower rates of urbanization and traditionally earlier marriages in the southern republics. Soviet Europe moved towards sub-replacement fertility, while Soviet Central Asia continued to exhibit population growth well above replacement-level fertility. The late 1960s and the 1970s witnessed a reversal of the declining trajectory of the rate of mortality in the USSR, and was especially notable among men of working age, but was also prevalent in Russia and other predominantly Slavic areas of the country.
Sources: en.wikipedia.org
The main proposal is modulation of neurotrophic factors such as brain-derived neurotrophic factor, supported largely by animal experiments. Receptor-level targets have not been firmly established. Most reviews describe the mechanism as only partially characterized.
The compound is registered as a medicine in Russia, so clinical work has concentrated there. Trials elsewhere are few and generally small. This geographic concentration is a recognized limitation in evidence reviews.
Some fraction may reach the central nervous system through olfactory pathways, and this is often cited as the rationale for the nasal route. The size of that fraction in humans is not well quantified. Blood concentrations after nasal dosing are low, which complicates measurement.
It is associated with the melanocortin receptor family, particularly subtypes found in the central nervous system. This interaction is separate from the adrenal pathway activated by full-length ACTH.